Cistron class 12
WebThe NCERT Class 12 Biology Exemplar for Chapter 6 comprises the Molecular Basis of Inheritance numericals, the Molecular Basis of Inheritance question bank, the Molecular … WebOct 25, 2024 · class-12 genetics-&-molecular-basis-of-inheritance-and-mutation 0votes 1answer Define a cistron. Giving examples differentiate between monocistronic and polycistronic unit. askedSep 2, 2024in Biologyby Aryangupta(92.0kpoints) class-12 molecular-basis-inheritance 0votes 1answer The terms cistron, recon and muton were …
Cistron class 12
Did you know?
WebApr 5, 2024 · Answer Verified 242.7k + views Hint: A section of RNA or DNA molecule which codes for the specific polypeptides during the process of protein synthesis is termed as … WebCistron is a segment of DNA that codes for a certain polypeptide or protein. Subject. Biology. Class. CBSE Class 12. Pre Boards. Practice to excel and get familiar with the …
WebApr 9, 2024 · Complete answer: Cistron is a DNA segment equivalent to a gene. It is the smallest unit of genetic material which codes for a single polypeptide and functions as a … WebBiopiracy is defined as ‘theft of various natural products and then selling them by getting a patent without giving any benefits or compensation back to the host country’.. i. For proper and lawful working of biopatent, the nation should be rich in bio-diversity, people residing there should have traditional knowledge and the nation should also have sufficient …
WebAnswer. If the sequence of coding strand in a transcription unit is written as follows : 5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA. 259 Views. Answer. If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA. 485 Views. WebA segment of DNA coding for polypeptide is called cistron. A cistron is basically a gene. If a stretch of replicating DNA contains a single cistron (or gene), it is called monocistronic. e.g. eukaryotes. If a stretch of replicating DNA contains more than one cistron, it is called polycistronic, e.g. bacteria and prokaryotes.
WebApr 17, 2024 · A gene is a cistron with particular B. One cistron comparises many genes C. Gene is physical moiety, while cistron is physiological one D. One gene can have many cistron class-12 gene its-expression-and-regulation Please log in or register to answer this question. 1 Answer 0 votes answered Apr 17, 2024 by Priyanshusingh (24.9k points)
WebOct 4, 2024 · MCQ Questions for Class 12 Biology: Ch 6 Molecular Basis of Inheritance 1. In Hershey and Chase experiments, radioactive 32P was used to culture bacteriophages which resulted in radioactive (a) Protein capsule of bacteriophage (b) Viral DNA (c) Bacterial capsule (d) Viral proteins (b) Viral DNA 2. did bon clay surviveWebWelcome to Cistron Systems Private Limited. Cistron Systems established in 1993 has been serving its customers with Sales and Service of Technology Medical Products for … did bonds ever fail a drug testWebApr 17, 2024 · The smallest unit of genetic material which when mustated produces a phenotypic effect is A. recon B. muton C. nucleic acid D. cistron class-12 gene its-expression-and-regulation Please log in or register to answer this question. 1 Answer 0 votes answered Apr 17, 2024 by Priyanshusingh (24.9k points) Correct Answer - B did bond die at the end of no time to dieWebThe word cistron is used to emphasize that genes exhibit a specific behavior in a cis-trans test; distinct positions (or loci) within a genome are cistronic. History. The words cistron … city index leverageWebCistron: Cistron are the smallest unit of genetic material which coded for a single polypeptide for the transmission of genetic information. Cistron are present in the DNA of prokaryotic and eukaryotic cells. The gene is a nucleotide sequence responsible for the synthesis of RNA molecules whereas cistron is a nucleotide sequence responsible for ... did bond really dieWebCistron is the segment of DNA having information for synthesis of a particular protein or RNA. The segment encodes for the synthesis of RNA or polypeptide of protein molecule. ... Trueman Solutions for Class 12 Biology II Chapter 6. 145 Qs > Related questions. A unit of functional segment of DNA which determine single polypeptide chain is known ... city index helpWebSep 8, 2024 · Gene vs Cistron Molecular Basis of Inheritance Class 12 NEET Biology at Ease 47K views 1 year ago Transcription Unit - Molecular Basis of Inheritance Class 12 Biology (2024-23)... city index mt4 account